Z7391 Details

Name: Z7391
Type: snp
Source: point
Position: chrY:9024757..9024757 (+ strand)
Length: 1
allele_anc: G
allele_der: A
comment: downstream of J2a PF5197/Z2397. approx. equivalent to YSC0000253
count_derived: 0
count_tested: 1
isogg_haplogroup: J2a1 (not listed)
load_id: Z7391
mutation: G to A
primer_f: Z7391_F AGGAATAATGCAGCCATGTGAC
primer_r: Z7391_R GGGTGAGGATACGACCGC
ref: Ray Banks (2015)
ycc_haplogroup: J2a (not listed)
yfull_node: J-Y9336
primary_id: 82693
gbrowse_dbid: chrY:database
>Z7391 class=Sequence position=chrY:9024757..9024757 (+ strand)
G