S15439 Details

Name: S15439
Type: snp
Source: point
Position: chrY:11975567..11975567 (+ strand)
Length: 1
allele_anc: G
allele_der: A
comment: Downstream FGC16096
count_derived: 1
count_tested: 1
isogg_haplogroup: J2a1 (not listed)
load_id: S15439
mutation: G to A
primer_f: S15439_F GCATTGCCTGAAAAGTAGGG
primer_r: S15439_R TCCTGTGTGCCATTCACTTC
ref: Jim Wilson (2014)
ycc_haplogroup: J2a-L198
yfull_node: J-L198
primary_id: 111789
gbrowse_dbid: chrY:database
>S15439 class=Sequence position=chrY:11975567..11975567 (+ strand)
G