PF5174 Details

Name: PF5174
Type: snp
Source: point
Position: chrY:8663540..8663540 (+ strand)
Length: 1
allele_anc: G
allele_der: A
comment: Extracted from genome study of Sardinian samples
count_derived: 5
count_tested: 10
isogg_haplogroup: J2a1a1a2 (not listed)
load_id: PF5174
mutation: G to A
primer_f: PF5174_F CAAGTGGCAGTTCTCCAATG
primer_r: PF5174_R TTACCAGGCAAAATGCCAAC
ref: Paolo Francalacci (2011)
ycc_haplogroup: J2-PF5197
yfull_node: J-PF5174
primary_id: 74133
gbrowse_dbid: chrY:database
>PF5174 class=Sequence position=chrY:8663540..8663540 (+ strand)
G