PF5172 Details

Name: PF5172
Type: snp
Source: point
Position: chrY:8014788..8014788 (+ strand)
Length: 1
allele_anc: G
allele_der: A
comment: Extracted from genome study of Sardinian samples Downsream L26 > PF5088 > Z2222 > PF5197
count_derived: 4
count_tested: 6
isogg_haplogroup: J2a1 (not listed)
load_id: PF5172
mutation: G to A
primer_f: PF5172_F GCAGAGCTCCTACAGAAGAGTC
primer_r: PF5172_R TGGTCACAGGTGAAATGATG
ref: Paolo Francalacci (2011)
ycc_haplogroup: J2-L26 (not listed)
yfull_node: J-PF5172
primary_id: 58326
gbrowse_dbid: chrY:database
>PF5172 class=Sequence position=chrY:8014788..8014788 (+ strand)
g