FGC16141 Details

Name: FGC16141
Type: snp
Source: point
Position: chrY:19588496..19588496 (+ strand)
Length: 1
allele_anc: C
allele_der: T
comment: Downstream of J-PF5169 (xPF5174)
count_derived: 0
count_tested: 6
isogg_haplogroup: J2 (not listed)
load_id: FGC16141
mutation: C to T
primer_f: FGC16141_F AGACAAGGTCTTTCCCTGTCAC
primer_r: FGC16141_R TTGAGGGAAAACAGGCTGAC
ref: Full Genomes Corp. (2014)
ycc_haplogroup: unknown
yfull_node: J-FGC16096
primary_id: 253872
gbrowse_dbid: chrY:database
>FGC16141 class=Sequence position=chrY:19588496..19588496 (+ strand)
c