FGC16096 Details

Name: FGC16096
Type: snp
Source: point
Position: chrY:14652234..14652234 (+ strand)
Length: 1
allele_anc: A
allele_der: T
comment: Downstream of J-PF5169 (xPF5174)
count_derived: 1
count_tested: 2
isogg_haplogroup: J2 (not listed)
load_id: FGC16096
mutation: A to T
primer_f: FGC16096_F GAACAAAATGGCCTCTCGTG
primer_r: FGC16096_R AAAAAGCTAAATTGAAATCGTCAAG
ref: Full Genomes Corp. (2014)
ycc_haplogroup: J2-PF5197
yfull_node: J-FGC16096
primary_id: 170739
gbrowse_dbid: chrY:database
>FGC16096 class=Sequence position=chrY:14652234..14652234 (+ strand)
a