Name: | Z7391 |
---|---|
Type: | snp |
Source: | point |
Position: | chrY:9024757..9024757 (+ strand) |
Length: | 1 |
allele_anc: | G |
allele_der: | A |
comment: | downstream of J2a PF5197/Z2397. approx. equivalent to YSC0000253 |
count_derived: | 1 |
count_tested: | 3 |
isogg_haplogroup: | J2a1 (not listed) |
load_id: | Check if Z7391 is available at YSEQ |
mutation: | G to A |
primer_f: | Z7391_F AGGAATAATGCAGCCATGTGAC |
primer_r: | Z7391_R GGGTGAGGATACGACCGC |
ref: | Ray Banks (2015) |
ycc_haplogroup: | J2a (not listed) |
yfull_node: | J-Y9336 |
primary_id: | 81103 |
gbrowse_dbid: | chrY:database |
>Z7391 class=Sequence position=chrY:9024757..9024757 (+ strand) G