| Name: | Z7391 |
|---|---|
| Type: | snp |
| Source: | point |
| Position: | chrY:9024757..9024757 (+ strand) |
| Length: | 1 |
| allele_anc: | G |
| allele_der: | A |
| comment: | downstream of J2a PF5197/Z2397. approx. equivalent to YSC0000253 |
| count_derived: | 1 |
| count_tested: | 3 |
| isogg_haplogroup: | J2a1 (not listed) |
| load_id: | Check if Z7391 is available at YSEQ |
| mutation: | G to A |
| primer_f: | Z7391_F AGGAATAATGCAGCCATGTGAC |
| primer_r: | Z7391_R GGGTGAGGATACGACCGC |
| ref: | Ray Banks (2015) |
| ycc_haplogroup: | J2a (not listed) |
| yfull_node: | J-Y9336 |
| primary_id: | 82772 |
| gbrowse_dbid: | chrY:database |
>Z7391 class=Sequence position=chrY:9024757..9024757 (+ strand) G