| Name: | S1688 |
|---|---|
| Type: | snp |
| Source: | point |
| Position: | chrY:20953587..20953587 (+ strand) |
| Length: | 1 |
| allele_anc: | C |
| allele_der: | A |
| comment: | Downstream of Z301 and upstream of U198. |
| count_derived: | 7 |
| count_tested: | 35 |
| isogg_haplogroup: | R1b1a1a2a1a1c2a |
| load_id: | Check if S1688 is available at YSEQ |
| mutation: | C to A |
| primer_f: | S1688_F CCTGCTTATTTCCCTGAGCTG |
| primer_r: | S1688_R GTGGCCAGGAGACCAATAAC |
| ref: | Jim Wilson (2014) |
| ycc_haplogroup: | R1b-U106 (not listed) |
| yfull_node: | R-S1684 |
| primary_id: | 291400 |
| gbrowse_dbid: | chrY:database |
>S1688 class=Sequence position=chrY:20953587..20953587 (+ strand) c